Primers

The UCDNA Sequencing Facility provides the following universal primers free of charge: Take a look at our new universal primers!!

Primer Sequence
M13F(-21)
5' GTAAAACGACGGCCAGT 3'
M13R
5' CAGGAAACAGCTATGAC 3'
T7prom
5' TAATACGACTCACTATAGGG 3'
T7term
5' GCTAGTTATTGCTCAGCGG 3'
T3prom
5' ATTAACCCTCACTAAAG 3'
SP6
5' GATTTAGGTGACACTATAG 3'
CMV-F
5' CGCAAATGGGCGGTAGGCGTG 3'
CMV-R
5' AGTAGGAAAGTCCCGTAAGG 3'
BGH-R
5' TAGAAGGCACAGTCGAGG 3'
pBAD-F
5' ATGCCATAGCATTTTTATCC 3'
pBAD-R
5' GATTTAATCTGTATCAGG 3'
pGEX5'
5' GGGCTGGCAAGCCACGTTTGGTG 3'
pGEX3'
5' CCGGGAGCTGCATGTGTCAGAGG 3'

If you are designing your own primer for sequencing, please be sure that you use a primer design program to avoid multiple annealing sites, primer-dimer, etc. Be aware that PCR primers do not always work for sequencing since cycle sequencing is a much more stringent protocol than PCR. Please see our FAQ page for more details. Here are some quidelines when designing your own primer for sequencing:

  • Primers should be at least 18 bases long to ensure good hybridization with template DNA.
  • Avoid runs of identical nucleotides, especially runs of 4 or more G's.
  • The G/C content should be in the range of 30-80%, preferably between 50-55%.
  • For cycle sequencing reactions, primers with Tm between 50-70 degrees C produce better results than primers outside of this range.
  • For primers with G/C content less than 50%, it may be necessary to extend the primer sequence beyond 18 bases to keep the Tm high enough.
  • Avoid primers that can hybridize to form dimers.
  • Avoid palindromes because they can form secondary structures.
  • Primers should be desalted and purified to industry standards.

**COVID-19 Update Jan 25 2021**

California's Statewide December stay-at-home order does not affect UC Davis Phase 2X research so UCDNA Sequencing will continue its normal services.

UCDNA Sequencing is available to receive DNA sequencing samples and fragment analysis runs during specific drop-off times on specific days. Runs and turn-around time on data will vary, depending on sample volume. Current turn-around time is approximately 2-3 days.

DNA Sample Drop-Off Schedule:

Storer Hall: Mon, Wed & Fri until 12pm

VM3B Annex: Mon, Wed & Fri until 11am

UCDMC: By request only

If this schedule does not work for you, please contact us 530-754-9259 and we will arrange another time for you to drop off your samples.

Sample Drop-off Instructions:

Storer Hall is locked and requires authorized access and COVID testing to enter the building so we have provided a FedEx envelope taped to the front doors of Storer Hall for sample drop-off. Place your samples in a clean Ziploc with your order number on it, drop them off in the envelope during our scheduled drop-off times and email DNAdivas@ucdavis.edu that they are there.

The VM3B annex appears to be unlocked now so you may drop samples off on any day of the week. We will pick up samples on Mondays, Wednesdays and Fridays at 11am.

If you have a 96-well plate or fragment analysis samples, you will need to schedule a time to drop off to us in person on Monday, Wednesday or Friday at Storer Hall. We will arrange to meet you at the front or back door of Storer Hall to receive your samples. Please wear your PPE, including mask and gloves.

To minimize any exposure, please exercise caution and refrain from placing orders if you or anyone in your lab has recently been ill. 

Shipping Instructions :

Our receiving department is open M-F so you can ship to us any day during the week. Please email DNAdivas@ucdavis.edu to let us know how many samples you will be sending and when.

Thank you from the UCDNA Sequencing Staff

 

 
 
© 2008. All Rights Reserved