Primers

The UCDNA Sequencing Facility provides the following universal primers free of charge: Take a look at our new universal primers!!

Primer Sequence
M13F(-21)
5' GTAAAACGACGGCCAGT 3'
M13R
5' CAGGAAACAGCTATGAC 3'
T7prom
5' TAATACGACTCACTATAGGG 3'
T7term
5' GCTAGTTATTGCTCAGCGG 3'
T3prom
5' ATTAACCCTCACTAAAG 3'
SP6
5' GATTTAGGTGACACTATAG 3'
CMV-F
5' CGCAAATGGGCGGTAGGCGTG 3'
CMV-R
5' AGTAGGAAAGTCCCGTAAGG 3'
BGH-R
5' TAGAAGGCACAGTCGAGG 3'
pBAD-F
5' ATGCCATAGCATTTTTATCC 3'
pBAD-R
5' GATTTAATCTGTATCAGG 3'
pGEX5'
5' GGGCTGGCAAGCCACGTTTGGTG 3'
pGEX3'
5' CCGGGAGCTGCATGTGTCAGAGG 3'

If you are designing your own primer for sequencing, please be sure that you use a primer design program to avoid multiple annealing sites, primer-dimer, etc. Be aware that PCR primers do not always work for sequencing since cycle sequencing is a much more stringent protocol than PCR. Please see our FAQ page for more details. Here are some quidelines when designing your own primer for sequencing:

  • Primers should be at least 18 bases long to ensure good hybridization with template DNA.
  • Avoid runs of identical nucleotides, especially runs of 4 or more G's.
  • The G/C content should be in the range of 30-80%, preferably between 50-55%.
  • For cycle sequencing reactions, primers with Tm between 50-70 degrees C produce better results than primers outside of this range.
  • For primers with G/C content less than 50%, it may be necessary to extend the primer sequence beyond 18 bases to keep the Tm high enough.
  • Avoid primers that can hybridize to form dimers.
  • Avoid palindromes because they can form secondary structures.
  • Primers should be desalted and purified to industry standards.

 

 
 
© 2008. All Rights Reserved